2(013)
- Brand: Unbranded
Description
Sphingosine kinase assays using purified recombinant SK1 (1 ng) and SK2 (10 ng) 44, 45 were performed with JTE-013 or DMSO using fatty acid-free BSA (0.1%) solubilized-sphingosine (10 µM), ATP (100 µM) and 1 μCi [γ 32P]ATP in 100 mM Tris/HCl (pH 7.4), containing 150 mM NaCl, 1 mM Na 3VO 4, 10 mM NaF (100 µl total reaction volume), incubated for 30 min at 37 °C, as described previously 46. SK1 degradation assays
Osada, M., Yatomi, Y., Ohmori, T., Ikeda, H. & Ozaki, Y. Enhancement of sphingosine 1-phosphate-induced migration of vascular endothelial cells and smooth muscle cells by an EDG-5 antagonist. Biochem. Biophys. Res. Commun. 299, 483–487. https://doi.org/10.1016/s0006-291x(02)02671-2 (2002). Pitman, M. R., Pham, D. H. & Pitson, S. M. Isoform-selective assays for sphingosine kinase activity. Methods Mol. Biol. 874, 21–31. https://doi.org/10.1007/978-1-61779-800-9_2 (2012). To generate doxycycline-inducible S1P 2 shRNA contructs the pTRIPz lentiviral vector was modified with the addition of a poly-linker as described previously 13. shRNA target sequences from Fellmann et al. 42, S1PR2 (5′ TGCTGTTGACAGTGAGCGCAAGGCACTGACTAGTCACATATAGTGAAGCCACAGATGTATATGTGACTAGTCAGTGCCTTATGCCTACTGCCTCGGA) and Renilla luciferase 713 negative control (5′ TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA). shRNA oligonucleotides were amplified using EcoRI MirE primers (5′ TAGAATTCTGCACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG, 3′ TCTCGAATTCTAGCCCCTTGAAGTCCGAG-GCATAGGC). PCR products were digested with EcoRI and cloned into pTRIPZ. To generate lentivirus, HEK293T cells were co-transfected with this vector (or empty pTRIPZ) and pLP1 (gag/pol), pLP2 (rev), pTAT and pVSVG vectors using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two days after transfection the media was changed from DMEM (10% FBS) to RPMI (10% FBS) and incubated for a further two days. The viral supernatant was then added to 5 × 10 6 MV411 cells containing 4 µg/ml polybrene and incubated for an additional 72 h prior to selection with 1 µg/ml of puromycin. Doxycycline induced RFP expression confirmed transduction efficiencies of > 80%. Li, C. et al. Sphingosine 1-phosphate receptor 2 antagonist JTE-013 increases the excitability of sensory neurons independently of the receptor. J. Neurophysiol. 108, 1473–1483. https://doi.org/10.1152/jn.00825.2011 (2012). Custodia, A. et al. Ceramide metabolism and Parkinson’s disease-therapeutic targets. Biomolecules https://doi.org/10.3390/biom11070945 (2021).
Kang, J., Lee, J. H. & Im, D. S. Topical application of S1P2 antagonist JTE-013 attenuates 2,4-dinitrochlorobenzene-induced atopic dermatitis in mice. Biomol. Ther. 28, 537–541. https://doi.org/10.4062/biomolther.2020.036 (2020). Lim, K. G. et al. Inhibition kinetics and regulation of sphingosine kinase 1 expression in prostate cancer cells: Functional differences between sphingosine kinase 1a and 1b. Int. J. Biochem. Cell Biol. 44, 1457–1464. https://doi.org/10.1016/j.biocel.2012.05.012 (2012). The International Standards Organisation (ISO) standard, ISO 3601 comprehensively defines both the o-ring and hardware dimensions for rod, piston, face seal grooves. McNaughton, M., Pitman, M., Pitson, S. M., Pyne, N. J. & Pyne, S. Proteasomal degradation of sphingosine kinase 1 and inhibition of dihydroceramide desaturase by the sphingosine kinase inhibitors, SKi or ABC294640, induces growth arrest in androgen-independent LNCaP-AI prostate cancer cells. Oncotarget 7, 16663–16675. https://doi.org/10.18632/oncotarget.7693 (2016).
Salas, A. et al. Sphingosine kinase-1 and sphingosine 1-phosphate receptor 2 mediate Bcr-Abl1 stability and drug resistance by modulation of protein phosphatase 2A. Blood 117, 5941–5952. https://doi.org/10.1182/blood-2010-08-300772 (2011). are usually free or discounted: Lawyer Referral & Information Service (LRIS) Committed to Public Service French, K. J. et al. Discovery and evaluation of inhibitors of human sphingosine kinase. Cancer Res. 63, 5962–5969 (2003).Roberts, J. L. et al. An assay for sphingosine kinase activity using biotinylated sphingosine and streptavidin-coated membranes. Anal. Biochem. 331, 122–129. https://doi.org/10.1016/j.ab.2004.03.030 (2004). Lum, K. M. et al. Mapping protein targets of bioactive small molecules using lipid-based chemical proteomics. ACS Chem. Biol. 12, 2671–2681. https://doi.org/10.1021/acschembio.7b00581 (2017). Generation of Human Embryonic Kidney (HEK)293 cells with doxycycline-inducible expression of FLAG-tagged SK1 was described previously 41. FlpIn SK1-FLAG HEK293 cells and HEK293T cells (ATCC) were maintained in DMEM supplemented with 10% fetal bovine Serum (FBS; HyClone ThermoFisher Scientific) and 1% penicillin–streptomycin (Gibco). MV411 AML cells (ATCC; authenticated by short tandem repeat profiling) were maintained in RPMI supplemented with 10% FBS (non-heat inactivated) and 1% penicillin–streptomycin (Gibco). Human Des1 (E.C. 1.14.19.17, DEGS1) cDNA (Genbank accession number NM_003676) was amplified from human bone marrow cDNA and FLAG epitope-tagged at the 3′ end by polymerase chain reaction (PCR) with Q5 (New England Biolabs, Ipswich, MA) and oligonucleotide primers 5′-TAGAATTCGCCACCATGGGGAGCCGCGTC-3′ and 5′-TAGGATCCTCACTTGTCATCGTCGTCCTTGTAGTCCTCCAGCACCATCTCTCCT-3′. The PCR product was treated with T4 polynucleotide kinase and then digested with EcoRI. pcDNA3 (Invitrogen) was digested with EcoRI and EcoRV prior to ligation with the PCR product to generate pcDNA3-Des1-FLAG. Sequencing verified the integrity of the cDNA.
French, K. J. et al. Pharmacology and antitumor activity of ABC294640, a selective inhibitor of sphingosine kinase-2. J. Pharmacol. Exp. Ther. 333, 129–139. https://doi.org/10.1124/jpet.109.163444 (2010). Purified Des1-FLAG protein was assayed with NBD-C6-dhCer in 1% fatty acid-free BSA, 1 mM NADPH, 50 µM (NH 4) 2Fe(SO 4) 2 (prepared with 3 × molar excess ascorbic acid) and recombinant cytochrome B5 (CYB5) in 50 mM Tris–HCl buffer (pH 7.2) with 1 mM DTT. The reaction was incubated at 37 °C for 30 min, and then terminated by the addition of methanol and centrifugation at 17,000× g for 5 min. Lipid extracts were transferred to glass HPLC vials and analysed as above. S1P lyase assay Pitman, M.R., Lewis, A.C., Davies, L.T. et al. The sphingosine 1-phosphate receptor 2/4 antagonist JTE-013 elicits off-target effects on sphingolipid metabolism. Even in times of a national crisis, fraudsters will go to extraordinary lengths to divert funds away from the public sector. Schwab, S. R. et al. Lymphocyte sequestration through S1P lyase inhibition and disruption of S1P gradients. Science 309, 1735–1739. https://doi.org/10.1126/science.1113640 (2005).Song, J. H., Kim, G. T., Park, K. H., Park, W. J. & Park, T. S. Bioactive sphingolipids as major regulators of coronary artery disease. Biomol. Ther. 29, 373–383. https://doi.org/10.4062/biomolther.2020.218 (2021). Simon, M. V. et al. Sphingolipids as critical players in retinal physiology and pathology. J. Lipid Res. 62, 100037. https://doi.org/10.1194/jlr.TR120000972 (2021). For the non-adherent MV411 cells, Des1 assays were performed as previously described 24. For assays using adherent HEK293T, the cells were harvested by trypsin and counted prior to use in the assay. Briefly, intact cells (at 1 × 10 6 cells/mL) were labeled with NBD-C6-dhCer (5 µM) in serum-free media and incubated on ice for 30 min. Cells were then pelleted and washed into fresh media (with 0.5% FBS) and dispensed into 24-well plates containing inhibitor/vehicle treatments (400 µL total) and incubated for 2 h at 37 °C and 5% CO 2. The cells were then harvested and pelleted via centrifugation at 500× g and resuspended in 100 µL H 2O. The samples were sonicated for 30 s in a bath sonicator (Diagenode) followed by the addition of 900µL cold methanol. Immediately before analysis, the samples were centrifuged for 3 min at 17,000× g and transferred to glass HPLC vials (Phenomenex). Samples (50 μL) were analysed on a Waters HPLC coupled to a fluorescence detector using a 30 cm C18 reverse-phase column (Phenomonex) eluted with 1 mL/min 20% H 2O and 80% acetonitrile with 0.1% trifluoroacetic acid. NBD-labelled substrate and product were quantitated with excitation and emission wavelengths of 465 nm and 530 nm, respectively. Des1 inhibition was calculated relative to vehicle as percentage peak area under the curve. Des1 assays using cell lysates
- Fruugo ID: 258392218-563234582
- EAN: 764486781913
-
Sold by: Fruugo